As far as I know, all certified organic seeds have to be non-GMO.

I have no idea what any of that means but maybe you should try an organic store like MOMS, Fresh Fields( Whole Foods), or Trader Joe's. That's all i can think!

oh geez.. c'mon.. basically all of our produce is "genetically modified"... the cross breeding techniques that have been used for ages to breed the most easily edible, nutritious, fruit/vegetable-bearing plants aren't all that different than most laboratory genetic engineering techniques.. molecular genetic techniques just allow us to make the modifications that we want more efficiently than by years of trial and error.

This is true Mayfly - but then you find out about the not so standard ones where they splice atlantic salmon genes with tomatos to make them frost resistant.....*shudder* vegetables should not have animal genes in them in my book....

Fish/tomato hybrids are certainly less traditional.. but it's really not nearly as freaky as it sounds.
The genetic code is so universal...just 4 basic molecules strung together into a pattern.

You've got a string of molecules that looks like this:

aggtaattccctctgaattaggcctaagt

and lets say.. those molecules in that order encode a protein that makes cells frost resistant. There's nothing inately "fishy" about that molecule.. it's just a protein that confers some cold-protection to the cell. there are already plenty or proteins that the fish and tomato have in common, plenty of genes that are already present in both. If they are able to take that string of molecules, in that order, and have the tomato able to produce that protein which will then protect the tomato cells against frost.. why not?

It's much more efficient than scanning the world for a tomato that has already mutated in such a way that its cells are protected against frost and then attempting to cross breed that mutant plant in a way that would preserve the frost-resistant characteristic... but the result would be the same.

it's just a less expensive and time consuming way to do it.

instead of having to rely on trial and error and hoping that the frost-resistant gene gets passed onto the next generation.. we can take that gene and just put it right where we want it and see if it works in the tomato! (yes, from a fish, but man.. DNA is all really really really really really similar when you get it down to just the DNA. at my work, we have a DNA synthesizer where i can type a genetic code into the computer and run the machine and out comes a bottle of DNA suspended in chemicals with the exact code that i have typed in. we could create the salmon frost-resistant gene without having salmon involved at all!)

It's all just strands of molecules that prompt the cell (whatever cell the DNA is in) to create a protein and then that protein has some activity in the cell. it's cool stuff :)

YIKES!!!!!!!!!!
LOL! I am happy to see I am not the only concerned consumer!
I try to by my seeds locally....have not done so last year as I planted no garden.....I will message you the Woman I had boughten from (seeds)and you can e mail her k?
Sherose

Organic and non-genetically modified are not the same thing. Organic means that no pesticides or herbicides are used but Mayfly is right, everything is modified in some way. Plant breeding has changed the appearance and nutritional content of everything we eat. We have been eating "GMO" for several decades and there have not been any reports of ill effects from GMOs. It is sad that GMO has been given such a negative connotation with everything we eat being modified. It really has improved our quality of life when you think about it. Good luck with the garden.

That is an awesome reply - and thanks for the info Mayfly (i rated it 'helpful'). Scientifically you are very correct,on a molecular level seriously...everything is so close. Intellecually I get it...but emotionally I can't get past it - Therein lies the dilemma! :-S

hehe. well thanks. I'm glad that you can accept the science of the matter. I'd never force a genetically modified tomato down someone's throat... if people want to find some old school seeds and plant their own food.. or maybe just scavenge through the wilderness to find the closest thing to unmodified food as possible ;) that's great. I just get riled when I see people protesting GMO food.. my gut reaction is "OMG eat whatever you want, but dont you DARE try to stop us from producing food that can be grown in any climate and can be used to feed the HUGE portion of the planet that doesn't have enough food!" I know that's not the goal of the protesters.. but but providing easy-to-grow food for famine-striken nations is the primary goal of genetic modifications to food.. so when you protest that or refuse to open your mind to the potentially fantastic things that the research could accomplish, it's really kind of rude (and I'm not accusing anyone here of being a protester or anything, I'm just explaining why I get very defensive when people are very wary of GMO foods...because I know that a lot of that concern comes from protest groups that put out a lot of misleading information about it!)